Review



human phenylalanine trna synthase  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Bio-Rad human phenylalanine trna synthase
    Human Phenylalanine Trna Synthase, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 18268 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+phenylalanine+trna+synthase/iQ+SYBR+Green+Supermix/pmc05811909__MDS___33___88___s001-5-70-81
    Average 98 stars, based on 18268 article reviews
    human phenylalanine trna synthase - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: The nasal and gut microbiome in Parkinson's disease and idiopathic rapid eye movement sleep behavior disorder
    Article Snippet: .. $: equal contributions *corresponding authors: Dr Paul Wilmes, Eco-Systems Biology Research Group, Luxembourg Centre for Systems Biomedicine, 6, avenue des Hauts-Fourneaux, 4362 Esch-sur-Alzette, Luxembourg; +352- 466644-6188; paul.wilmes@uni.lu Dr Brit Mollenhauer, Paracelsus-Elena-Klinik, Klinikstraße 16, 34128 Kassel, Germany; +49-561-6009-200; brit.mollenhauer@paracelsus-kliniken.de 2 Supplementary methods qPCR quantification of bacterial and human DNA DNA extracted from nasal wash fluid and corresponding mock-extraction controls was amplified in duplicates, using primers targeting prokaryotes (F_Bact1369 and R_Prok1492)1,2 and human phenylalanine-tRNA-synthase (PHA_Syn5- FWD_AAGCCCAACGATGATCAAAT; PHA_Syn5- REV_CAGGGGACTGTCATACACCA) using iQ SYBR Green Supermix (Bio-Rad Laboratories) on a LightCycler 480 (Roche Diagnostics, Germany). ..

    Amplification:

    Article Title: The nasal and gut microbiome in Parkinson's disease and idiopathic rapid eye movement sleep behavior disorder
    Article Snippet: .. $: equal contributions *corresponding authors: Dr Paul Wilmes, Eco-Systems Biology Research Group, Luxembourg Centre for Systems Biomedicine, 6, avenue des Hauts-Fourneaux, 4362 Esch-sur-Alzette, Luxembourg; +352- 466644-6188; paul.wilmes@uni.lu Dr Brit Mollenhauer, Paracelsus-Elena-Klinik, Klinikstraße 16, 34128 Kassel, Germany; +49-561-6009-200; brit.mollenhauer@paracelsus-kliniken.de 2 Supplementary methods qPCR quantification of bacterial and human DNA DNA extracted from nasal wash fluid and corresponding mock-extraction controls was amplified in duplicates, using primers targeting prokaryotes (F_Bact1369 and R_Prok1492)1,2 and human phenylalanine-tRNA-synthase (PHA_Syn5- FWD_AAGCCCAACGATGATCAAAT; PHA_Syn5- REV_CAGGGGACTGTCATACACCA) using iQ SYBR Green Supermix (Bio-Rad Laboratories) on a LightCycler 480 (Roche Diagnostics, Germany). ..

    SYBR Green Assay:

    Article Title: The nasal and gut microbiome in Parkinson's disease and idiopathic rapid eye movement sleep behavior disorder
    Article Snippet: .. $: equal contributions *corresponding authors: Dr Paul Wilmes, Eco-Systems Biology Research Group, Luxembourg Centre for Systems Biomedicine, 6, avenue des Hauts-Fourneaux, 4362 Esch-sur-Alzette, Luxembourg; +352- 466644-6188; paul.wilmes@uni.lu Dr Brit Mollenhauer, Paracelsus-Elena-Klinik, Klinikstraße 16, 34128 Kassel, Germany; +49-561-6009-200; brit.mollenhauer@paracelsus-kliniken.de 2 Supplementary methods qPCR quantification of bacterial and human DNA DNA extracted from nasal wash fluid and corresponding mock-extraction controls was amplified in duplicates, using primers targeting prokaryotes (F_Bact1369 and R_Prok1492)1,2 and human phenylalanine-tRNA-synthase (PHA_Syn5- FWD_AAGCCCAACGATGATCAAAT; PHA_Syn5- REV_CAGGGGACTGTCATACACCA) using iQ SYBR Green Supermix (Bio-Rad Laboratories) on a LightCycler 480 (Roche Diagnostics, Germany). ..



    Similar Products

    98
    Bio-Rad human phenylalanine trna synthase
    Human Phenylalanine Trna Synthase, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+phenylalanine+trna+synthase/iQ+SYBR+Green+Supermix/pmc05811909__MDS___33___88___s001-5-70-81
    Average 98 stars, based on 1 article reviews
    human phenylalanine trna synthase - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results